View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17935_high_12 (Length: 282)

Name: NF17935_high_12
Description: NF17935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17935_high_12
NF17935_high_12
[»] chr5 (3 HSPs)
chr5 (1-277)||(32077206-32077482)
chr5 (20-136)||(31004363-31004479)
chr5 (17-69)||(31009453-31009505)


Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 32077206 - 32077482
Alignment:
1 aacatgaatgttgatattgttggagacaaggagtttgcagaggttcatcatagggttgatattgcctcgtacaggaaatggcatggccaccatgtggcag 100  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32077206 aacatgaatgttgctattgttggagacaaggagtttgcagaggttcatcatagggttgatattgcctcgtacaggaaatggcatggccaccatgtggcag 32077305  T
101 agggaagttggtagggcttccatagcaattttgggaaagaataagaatatcaagattcaaagtttcaatcttcatctttgtctatcttctctcaaagata 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32077306 agggaagttggtagggcttccatagcaattttgggaaagaataagaatatcaagattcaaagtttcaatcttcatctttgtctatcttctctcaaagata 32077405  T
201 agaacggtcccatctctggctacactcccttttcccaacttttgattaaccnnnnnnntatattctcccctttgata 277  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||       |||||||||||||| ||||    
32077406 agaacggtcccatctctggccacactcccttttcccaacttttgattaaccaaaaaaatatattctccccttcgata 32077482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 136
Target Start/End: Complemental strand, 31004479 - 31004363
Alignment:
20 ttggagacaaggagtttgcagaggttcatcatagggttgatattgcctcgtacaggaaatggcatggccaccatgtggcagagggaagttggtagggctt 119  Q
    ||||||| |||||| ||||| ||||||||||| |||||||| | ||||| | ||||  | |||||||| |  ||||||  || | |||||||| | | ||    
31004479 ttggagataaggagcttgcataggttcatcattgggttgatgtggcctcttgcaggggaaggcatggctagtatgtggttgaagaaagttggtggtgatt 31004380  T
120 ccatagcaattttggga 136  Q
    |||| ||||||||||||    
31004379 ccattgcaattttggga 31004363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 17 - 69
Target Start/End: Complemental strand, 31009505 - 31009453
Alignment:
17 ttgttggagacaaggagtttgcagaggttcatcatagggttgatattgcctcg 69  Q
    ||||||||||  ||||||||||| ||||||||||| |||||||| | ||||||    
31009505 ttgttggagatgaggagtttgcataggttcatcattgggttgatgtggcctcg 31009453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University