View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17935_high_7 (Length: 350)
Name: NF17935_high_7
Description: NF17935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17935_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 288; Significance: 1e-161; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 328
Target Start/End: Complemental strand, 32077212 - 32076885
Alignment:
| Q |
1 |
tcatgtttcctttgtagtcactgaagaatggctaagcttcatctcctccgagccaaaacccgacaacataagctttcgttcgatcccgaacgttattccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32077212 |
tcatgtttcctttgtagtcactgaagaatggctaagcttcatctcctccgagccaaaacctgacaacataagctttcgttcgggatcgaacgttattccc |
32077113 |
T |
 |
| Q |
101 |
tccgaacttatccgcggccgcgaccatcctgcattcatggaagatgtcatgacaaagatggaagcaccatttgaggagctacttgacctacttgatcacc |
200 |
Q |
| |
|
|| ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32077112 |
tcggaacttatctgtggccgcgaccatcctgcattcatggaagatgtcatgacaaagatggaagcaccctttgaggagctacttgacctacttgatcacc |
32077013 |
T |
 |
| Q |
201 |
ctccctctatcattgtttatgatactttgttgtattgggctgttgtggttgcaaaccgaaggaatattccagcagcattgttttggcctatgccagcatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32077012 |
ctccctctatcattgtttatgatactttgttgtattgggctgttgtggttgcaaaccgaaggaatattccagcagcattgttttggcctatgccagcatc |
32076913 |
T |
 |
| Q |
301 |
tattttctctgtgttcctacaccaacac |
328 |
Q |
| |
|
||||||||||||||||||||| |||||| |
|
|
| T |
32076912 |
tattttctctgtgttcctacatcaacac |
32076885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 17 - 143
Target Start/End: Original strand, 31004508 - 31004634
Alignment:
| Q |
17 |
gtcactgaagaatggctaagcttcatctcctccgagccaaaacccgacaacataagctttcgttcgatcccgaacgttattccctccgaacttatccgcg |
116 |
Q |
| |
|
||||| ||||||||| ||| ||||||||||||||| ||||||||||||||||| ||||| ||||||||||| |||||| |||| |||||||| || || | |
|
|
| T |
31004508 |
gtcaccgaagaatggttaaccttcatctcctccgaaccaaaacccgacaacatcagcttccgttcgatccccaacgttgttccatccgaactcattcgtg |
31004607 |
T |
 |
| Q |
117 |
gccgcgaccatcctgcattcatggaag |
143 |
Q |
| |
|
| |||||||| ||| |||||||||| |
|
|
| T |
31004608 |
gtcgcgaccacgctgacttcatggaag |
31004634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 186
Target Start/End: Original strand, 30987791 - 30987837
Alignment:
| Q |
140 |
gaagatgtcatgacaaagatggaagcaccatttgaggagctacttga |
186 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||| |||| ||||| |
|
|
| T |
30987791 |
gaagctgtcatgacaaagatggaagcaccgtttgagaagcttcttga |
30987837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University