View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17935_low_13 (Length: 282)
Name: NF17935_low_13
Description: NF17935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17935_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 32077206 - 32077482
Alignment:
| Q |
1 |
aacatgaatgttgatattgttggagacaaggagtttgcagaggttcatcatagggttgatattgcctcgtacaggaaatggcatggccaccatgtggcag |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32077206 |
aacatgaatgttgctattgttggagacaaggagtttgcagaggttcatcatagggttgatattgcctcgtacaggaaatggcatggccaccatgtggcag |
32077305 |
T |
 |
| Q |
101 |
agggaagttggtagggcttccatagcaattttgggaaagaataagaatatcaagattcaaagtttcaatcttcatctttgtctatcttctctcaaagata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32077306 |
agggaagttggtagggcttccatagcaattttgggaaagaataagaatatcaagattcaaagtttcaatcttcatctttgtctatcttctctcaaagata |
32077405 |
T |
 |
| Q |
201 |
agaacggtcccatctctggctacactcccttttcccaacttttgattaaccnnnnnnntatattctcccctttgata |
277 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
32077406 |
agaacggtcccatctctggccacactcccttttcccaacttttgattaaccaaaaaaatatattctccccttcgata |
32077482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 136
Target Start/End: Complemental strand, 31004479 - 31004363
Alignment:
| Q |
20 |
ttggagacaaggagtttgcagaggttcatcatagggttgatattgcctcgtacaggaaatggcatggccaccatgtggcagagggaagttggtagggctt |
119 |
Q |
| |
|
||||||| |||||| ||||| ||||||||||| |||||||| | ||||| | |||| | |||||||| | |||||| || | |||||||| | | || |
|
|
| T |
31004479 |
ttggagataaggagcttgcataggttcatcattgggttgatgtggcctcttgcaggggaaggcatggctagtatgtggttgaagaaagttggtggtgatt |
31004380 |
T |
 |
| Q |
120 |
ccatagcaattttggga |
136 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
31004379 |
ccattgcaattttggga |
31004363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 17 - 69
Target Start/End: Complemental strand, 31009505 - 31009453
Alignment:
| Q |
17 |
ttgttggagacaaggagtttgcagaggttcatcatagggttgatattgcctcg |
69 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||| |||||||| | |||||| |
|
|
| T |
31009505 |
ttgttggagatgaggagtttgcataggttcatcattgggttgatgtggcctcg |
31009453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University