View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17936_high_4 (Length: 445)
Name: NF17936_high_4
Description: NF17936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17936_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 77 - 434
Target Start/End: Complemental strand, 18645710 - 18645349
Alignment:
| Q |
77 |
tatatgagattgttattcaactgttttatttactatatgctttactttaattcaatattgtctttgtgaagtggnnnnnnnnnnnnnnnnnnnnnnggct |
176 |
Q |
| |
|
||||||||||||||||||||| || ||||||| |||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
18645710 |
tatatgagattgttattcaacagtgttatttattatatgctttactttaattcaatattgtctttgtgaagtgattttctttttgagagtttttttggtt |
18645611 |
T |
|
| Q |
177 |
gtgtttgatttcagagaagcagcgcaagattgcagaatactataaacaacaggagaggctacttgcaggctataatgacatggatactatgaccgaaaca |
276 |
Q |
| |
|
||||||||||||||||||||| |||||| | ||||||||||||||||||||||||| ||| |||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
18645610 |
gtgtttgatttcagagaagcaacgcaaggtagcagaatactataaacaacaggagaagctccttgagggctataatgacatggatactatgactgaaaca |
18645511 |
T |
|
| Q |
277 |
tgactttttccaggaagtcttaccgagttagattgttt----tatcaccataattgcgggcgcgattgttatcaatgtgtcaccaataacacgactgaaa |
372 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| | |||||||||||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
18645510 |
ggactttttccaggaagtcttaccgaggtagattgtttattttgtcaccataattgcgggcgcgattgataccaatgtgccaccaataacacgactgaaa |
18645411 |
T |
|
| Q |
373 |
cacgctccttgattttgtagcaaatgtggccaatgcggaagcaatttctgttgtcatttcat |
434 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18645410 |
aacgctccttgattttgtagcaaatgtggccaatgcggaagcaatttctgttgtcatttcat |
18645349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University