View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17938_high_2 (Length: 362)
Name: NF17938_high_2
Description: NF17938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17938_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 20 - 349
Target Start/End: Original strand, 50538310 - 50538639
Alignment:
| Q |
20 |
gtctgatccttctggtttccaagaacaggtccaccaacatcacaacacaactagcggtgttgttggtagttctgttcttggaaacgaatttgcgatgtct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50538310 |
gtctgatccttctggtttccaagaacaggtccaccaacatcacaacacaactagcggcgttgttggtagttctgttcttggaaacgaatttgcgatgtct |
50538409 |
T |
|
| Q |
120 |
caatcacaacaatatcaaaaatttcaggatcagaatcagaatgtgcttcatcagcagcggcaagcagtgccatctttgttatataatagtgattataaca |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50538410 |
caatcacaacaatatcaaaaatttcaggatcagaatcagaatgtgcttcatcaccagcggcaagcagtgccatctttgttatataatagtgattataaca |
50538509 |
T |
|
| Q |
220 |
actccttcaacatttctccacttttgaatgttgttaactctgctgataatttgatgatctcttcagcatcttttggtggatttcttcaaaatcaagaaaa |
319 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
50538510 |
actccttcaacatttctccactttcgaatattgttaactctgctgataatttgatgatctcttcaacatcttttggtggatttcttcaaaatcaagaaaa |
50538609 |
T |
|
| Q |
320 |
ttatggtggaggcaattcttctgtgtcttc |
349 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |
|
|
| T |
50538610 |
ttatggtggaggcaattcttctctgtcttc |
50538639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University