View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17938_high_7 (Length: 262)
Name: NF17938_high_7
Description: NF17938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17938_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 6 - 245
Target Start/End: Original strand, 10478706 - 10478953
Alignment:
| Q |
6 |
gattctgaattcatgaaatgcttgctttttatcacaattatcatcattgatacaaatgtcttctatttggcttcagtgatgtcttaaatcaaatcttggc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10478706 |
gattctgaattcatgaaatgcttgctttttatcacaattatcatcattgatacaaatgtcttctatttggcttcagtgatgtcttaaatcaaatcttggc |
10478805 |
T |
|
| Q |
106 |
ttctctagctcctcatgctcatcagtcatcaatttcataatctaatttgcgatcaaagtcaactaacaaagattgttg--------gttcttttactggt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10478806 |
ttctctagctcctcatgctcatcagtcatcaatttcataatctaatttgcgatcaaagtcaactaacaaagattgttggttcttctgttcttttactggt |
10478905 |
T |
|
| Q |
198 |
tggtccttaaccaccttgagaagcaacaatttgctgtaatatcaaata |
245 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10478906 |
tggtccttaaccaccttcagaagcaacaatttgctgtaatatcaaata |
10478953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University