View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17938_low_7 (Length: 326)
Name: NF17938_low_7
Description: NF17938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17938_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 15 - 314
Target Start/End: Complemental strand, 28226456 - 28226157
Alignment:
| Q |
15 |
cacaaatatgagtgtggctgtggagaacttgaaaaagaatatacgtcattataagaaaatgcagatttcagaaaggcaagagttcactaggaatgggaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28226456 |
cacaaatatgagtgtggctgtggaaaacttgaaaaagaatatacgtcattataagaaaatgcagatttcagaaaggcaagagttcactaggaatgggaaa |
28226357 |
T |
|
| Q |
115 |
agaagttatttatgcatctgctcttttcgatttcttatgattctttagaatatgatgcatatgaaaatgaatggaaaaagggcatgtgaaattcacctca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28226356 |
agaagttatttatgcatctgctcttttcgatttcttatgattctttagaatatgatgcatatgaaaatgaatggaaaaagggcatgtgaaattcacctca |
28226257 |
T |
|
| Q |
215 |
agatagatatcaatggctttgtagaccccatcaaagcaatcccttgcagaatcaggcaaacattctgcaactccaagaaatttagagatctttaggttct |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28226256 |
agatagatatcaatggctttgtagaccccatcaaagcaatcccttgcagaatcaggcaaacattctgcaactccaagaaatttagagatctttaggttct |
28226157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 205 - 314
Target Start/End: Original strand, 13040378 - 13040487
Alignment:
| Q |
205 |
attcacctcaagatagatatcaatggctttgtagaccccatcaaagcaatcccttgcagaatcaggcaaacattctgcaactccaagaaatttagagatc |
304 |
Q |
| |
|
|||||||||||| ||||| ||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||| ||||| | || |||||||||||| |
|
|
| T |
13040378 |
attcacctcaaggtagatgtcaatggctctatagaccccatcaaagcaatcccttgcaaaatcaggcaaacattctacaacttctaggaatttagagatc |
13040477 |
T |
|
| Q |
305 |
tttaggttct |
314 |
Q |
| |
|
| ||||||| |
|
|
| T |
13040478 |
tcaaggttct |
13040487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University