View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17939_high_8 (Length: 265)
Name: NF17939_high_8
Description: NF17939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17939_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 88 - 188
Target Start/End: Complemental strand, 9622410 - 9622310
Alignment:
| Q |
88 |
gctaccatttgatgaatttgattcatatgtaaatgaaccactatccgttcttggtaaatttaaagcttttatcctaatagcttttggtaaataaacttgg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9622410 |
gctaccatttgatgaatttgattcatatgtaaatgaaccactatccgttcttggtaaatttaaagcttttatcctaatagcttttggtaaataaacttgg |
9622311 |
T |
|
| Q |
188 |
a |
188 |
Q |
| |
|
| |
|
|
| T |
9622310 |
a |
9622310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University