View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17939_low_10 (Length: 243)
Name: NF17939_low_10
Description: NF17939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17939_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 111 - 225
Target Start/End: Original strand, 51629762 - 51629876
Alignment:
| Q |
111 |
ttgatgaagttactgattttggacagctattatacatctagagcggctaaattttttagcctaagtttgcatgcatggattgatattcctttattaaaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51629762 |
ttgatgaagttactgattttggacagctattatacatctagagcggctaaattttttagcctaagtttgcatgcatggattgatattcctttattaaaca |
51629861 |
T |
 |
| Q |
211 |
ttcttttatagaatg |
225 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
51629862 |
ttcttttatagaatg |
51629876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 51629487 - 51629600
Alignment:
| Q |
1 |
gctaattaactcccttcaattgatggtcaatttagtcttaaatatgcctataattttttagcttctcagatggatatggaaagagaatatactcatagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51629487 |
gctaattaactcccttcaattgatggtcaatttagtcttaaatatgcctataattttttagcttctcagatggatatggaaagagaatatactcatagtt |
51629586 |
T |
 |
| Q |
101 |
ttcacatggcttga |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
51629587 |
ttcacatggcttga |
51629600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University