View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17940_high_6 (Length: 244)

Name: NF17940_high_6
Description: NF17940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17940_high_6
NF17940_high_6
[»] scaffold0019 (1 HSPs)
scaffold0019 (13-242)||(108295-108524)
[»] chr3 (2 HSPs)
chr3 (82-183)||(11994826-11994927)
chr3 (13-70)||(11994712-11994769)
[»] scaffold0014 (3 HSPs)
scaffold0014 (154-218)||(141938-142002)
scaffold0014 (13-70)||(141754-141811)
scaffold0014 (97-135)||(141900-141938)


Alignment Details
Target: scaffold0019 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: scaffold0019
Description:

Target: scaffold0019; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 13 - 242
Target Start/End: Complemental strand, 108524 - 108295
Alignment:
13 gatagtgtatgtagcttgggttttatgtgattttggtttatattaggtggcttaagagacagatttggctcatagaaagtgctttgttataaagattatg 112  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
108524 gatagtgtatgtagcttgggttttatgtgattttggtttagattaggtggcttaagagacagatttggctcatagaaagtgctttgttataaagattatg 108425  T
113 taaacataatcaaatttagggatgtttgattgacatgttactcttagagacaacaagatactcatagattgatgctttagaaatttggtggcatatgctc 212  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
108424 taaacataatcaaatttagggacgtttgattgacatgttactcttagagacaacaagatactcatagattgatgctttagaaatttggtggcatatgctc 108325  T
213 atagatattactcttgcagtatgacctatg 242  Q
    ||||||||||||||||||||||||| ||||    
108324 atagatattactcttgcagtatgacttatg 108295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 82 - 183
Target Start/End: Original strand, 11994826 - 11994927
Alignment:
82 tcatagaaagtgctttgttataaagattatgtaaacataatcaaatttagggatgtttgattgacatgttactcttagagacaacaagatactcatagat 181  Q
    ||||||||| || | |||||||| |||||||||||| ||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |||||||||    
11994826 tcatagaaaatgttgtgttataatgattatgtaaacgtaatcaagtttagggatctttgattgacatgttactcttagagacaacaagatgctcatagat 11994925  T
182 tg 183  Q
    ||    
11994926 tg 11994927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 70
Target Start/End: Original strand, 11994712 - 11994769
Alignment:
13 gatagtgtatgtagcttgggttttatgtgattttggtttatattaggtggcttaagag 70  Q
    |||||| ||||||||||||  ||||||||||||||||||| |||||||||||| ||||    
11994712 gatagtatatgtagcttggtgtttatgtgattttggtttaaattaggtggcttcagag 11994769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: scaffold0014
Description:

Target: scaffold0014; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 154 - 218
Target Start/End: Original strand, 141938 - 142002
Alignment:
154 tcttagagacaacaagatactcatagattgatgctttagaaatttggtggcatatgctcatagat 218  Q
    |||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||    
141938 tcttagagacaacaagatgcttatagattgatgcttcagaaatttggtggcatatgctcatagat 142002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 13 - 70
Target Start/End: Original strand, 141754 - 141811
Alignment:
13 gatagtgtatgtagcttgggttttatgtgattttggtttatattaggtggcttaagag 70  Q
    ||||||||| |||||||||  ||||||||||||| ||||| |||||||||||| ||||    
141754 gatagtgtaagtagcttggtgtttatgtgatttttgtttagattaggtggcttcagag 141811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 135
Target Start/End: Original strand, 141900 - 141938
Alignment:
97 tgttataaagattatgtaaacataatcaaatttagggat 135  Q
    |||||||| |||||||||||||||||||| |||||||||    
141900 tgttataatgattatgtaaacataatcaagtttagggat 141938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University