View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17940_high_8 (Length: 235)
Name: NF17940_high_8
Description: NF17940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17940_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 25 - 220
Target Start/End: Original strand, 26002695 - 26002886
Alignment:
| Q |
25 |
ttttcaataatattattgttcgtattatagtatgtttcatggcttttccaatccattagacataatgaagttttccccacacggaaatctaacagtgaag |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
26002695 |
ttttcaataatattattgttcgtattatagtatgtttcatggcttttcctattcattagacattatgaaattttccccacacgggaatctaacagtgaag |
26002794 |
T |
|
| Q |
125 |
acgttcattcacttaattagagagcatatataacctatagtattgcaaattagccaccgcacacctctaaataaaaattttattgactattgcaac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||||| |
|
|
| T |
26002795 |
acgttcattcacttaattagagagcatatataacctatagtattgcaaattagccaccgcacacttc---ataaaaa-cttattgactattgcaac |
26002886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University