View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17940_low_6 (Length: 244)
Name: NF17940_low_6
Description: NF17940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17940_low_6 |
 | |
|
| [»] scaffold0019 (1 HSPs) |
| | |
|
| [»] scaffold0014 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0019 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 13 - 242
Target Start/End: Complemental strand, 108524 - 108295
Alignment:
| Q |
13 |
gatagtgtatgtagcttgggttttatgtgattttggtttatattaggtggcttaagagacagatttggctcatagaaagtgctttgttataaagattatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
108524 |
gatagtgtatgtagcttgggttttatgtgattttggtttagattaggtggcttaagagacagatttggctcatagaaagtgctttgttataaagattatg |
108425 |
T |
|
| Q |
113 |
taaacataatcaaatttagggatgtttgattgacatgttactcttagagacaacaagatactcatagattgatgctttagaaatttggtggcatatgctc |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
108424 |
taaacataatcaaatttagggacgtttgattgacatgttactcttagagacaacaagatactcatagattgatgctttagaaatttggtggcatatgctc |
108325 |
T |
|
| Q |
213 |
atagatattactcttgcagtatgacctatg |
242 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
108324 |
atagatattactcttgcagtatgacttatg |
108295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 82 - 183
Target Start/End: Original strand, 11994826 - 11994927
Alignment:
| Q |
82 |
tcatagaaagtgctttgttataaagattatgtaaacataatcaaatttagggatgtttgattgacatgttactcttagagacaacaagatactcatagat |
181 |
Q |
| |
|
||||||||| || | |||||||| |||||||||||| ||||||| ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11994826 |
tcatagaaaatgttgtgttataatgattatgtaaacgtaatcaagtttagggatctttgattgacatgttactcttagagacaacaagatgctcatagat |
11994925 |
T |
|
| Q |
182 |
tg |
183 |
Q |
| |
|
|| |
|
|
| T |
11994926 |
tg |
11994927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 70
Target Start/End: Original strand, 11994712 - 11994769
Alignment:
| Q |
13 |
gatagtgtatgtagcttgggttttatgtgattttggtttatattaggtggcttaagag |
70 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
11994712 |
gatagtatatgtagcttggtgtttatgtgattttggtttaaattaggtggcttcagag |
11994769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 154 - 218
Target Start/End: Original strand, 141938 - 142002
Alignment:
| Q |
154 |
tcttagagacaacaagatactcatagattgatgctttagaaatttggtggcatatgctcatagat |
218 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
141938 |
tcttagagacaacaagatgcttatagattgatgcttcagaaatttggtggcatatgctcatagat |
142002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 13 - 70
Target Start/End: Original strand, 141754 - 141811
Alignment:
| Q |
13 |
gatagtgtatgtagcttgggttttatgtgattttggtttatattaggtggcttaagag |
70 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||| ||||| |||||||||||| |||| |
|
|
| T |
141754 |
gatagtgtaagtagcttggtgtttatgtgatttttgtttagattaggtggcttcagag |
141811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 135
Target Start/End: Original strand, 141900 - 141938
Alignment:
| Q |
97 |
tgttataaagattatgtaaacataatcaaatttagggat |
135 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
141900 |
tgttataatgattatgtaaacataatcaagtttagggat |
141938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University