View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17941_high_18 (Length: 373)
Name: NF17941_high_18
Description: NF17941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17941_high_18 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 18 - 373
Target Start/End: Original strand, 3709647 - 3710002
Alignment:
| Q |
18 |
ccttaaagctctcatgtttggttcaaagaggatcaaggtcttcaccttcatcaggcacgctccacttctaggctagtcgctgatgggaagttgcactaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3709647 |
ccttaaagctctcatgtttggttcaaagaggatcaaggtcttcaccttcatcaggcacgctccacttctaggctagtcgctgatgggaagttgcactaca |
3709746 |
T |
 |
| Q |
118 |
ttcaccttcatcctagggttccctttgagggaagacatgaaaatatacatcttggtccatgccttgttcttatagaatacagtgtcaacaacactagagg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3709747 |
ttcaccttcatcctagggttccctttgagggaagacatgaaaatatacatcttggtcgatgccttgttcttatagaatacagtgtcaacaacactagagg |
3709846 |
T |
 |
| Q |
218 |
agtaaaacagatatcaagtcacatatcccctgagatgttgacacatattttaaaacgaattaaggagctcattgctttcctatttacacaacaatactac |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3709847 |
agtaaaacagatatcaagtcacatatcccctgagatgttgacacatattttaaaacgaattaaggagctcattgctttcctatttacacaacaatactac |
3709946 |
T |
 |
| Q |
318 |
tagtcctaacaaaacttgcagggtaatgtgcaaatcaactgtgtctataagttaac |
373 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3709947 |
tagtcctaactaaacttgcaggtcaatgtgcaaatcaactgtgtctataagttaac |
3710002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University