View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17941_high_20 (Length: 369)
Name: NF17941_high_20
Description: NF17941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17941_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 244
Target Start/End: Original strand, 8461783 - 8462009
Alignment:
| Q |
18 |
caaggcttgtggatgaaggtaaaattgatcttatagaggctttagatatgtgcaggtgccttctcattgtttttatgctaatgactttatggtatactac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8461783 |
caaggcttgtggatgaaggtaaaattgatcttatagaggctttagatatgtgcaggtgccttctcattgtttttatgctaatgactttatggtatactac |
8461882 |
T |
 |
| Q |
118 |
aaaggtaagctatctagcctggaggctcataaagctattttttctagataagatgtttgttctagtcagattataaacgcaatgaaatcttctattcatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8461883 |
aaaggtaagctatctagcctggaggctcatgaagctattttttctagatatgatgtttgttctagtcagattataaacgcaatgaaatcttctattcatt |
8461982 |
T |
 |
| Q |
218 |
ttggtggtatcaatcaaactagaatgg |
244 |
Q |
| |
|
|||||||||||||||||| |||||||| |
|
|
| T |
8461983 |
ttggtggtatcaatcaaaatagaatgg |
8462009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 242 - 276
Target Start/End: Original strand, 8462041 - 8462075
Alignment:
| Q |
242 |
tggttctttacctttacggctatacttgccttgaa |
276 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8462041 |
tggttctttacctttacggctttacttgccttgaa |
8462075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University