View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17941_high_32 (Length: 298)
Name: NF17941_high_32
Description: NF17941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17941_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 25 - 292
Target Start/End: Original strand, 498100 - 498367
Alignment:
| Q |
25 |
acatacataaatggggcggagcttgagaaaagagcatgggttaaaagtttagtctttgatagcaatcacaatgtttaaattggtactatttaataacaat |
124 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
498100 |
acatacatacatggggcggagcttgagaaaagagcatgggttaaaagtttagtctttgataacaatcacaatgtttaaattggtactatttaataacaat |
498199 |
T |
 |
| Q |
125 |
gacaacagttttggtcatcataaatatcaatgctcaaaattgttgattagagtcattttaaaaccgttgcctatcgtataacaatgcctcagnnnnnnnn |
224 |
Q |
| |
|
||||||| ||| |||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
498200 |
gacaacaatttcggtcatcataaacatcaatgctcaaaattgttgattagagtaattttaaaaccgttgcctatcgtataacaatgcctcagtttttttc |
498299 |
T |
 |
| Q |
225 |
nnnnnnnngctagtgttgcctcgatgttaaaaatcgttgtcgggtaatccacaacacctcatactaac |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||| ||||||| |||||| |
|
|
| T |
498300 |
ttttttttgctagtgttgcctcgatgttaaaaatcgttgttgggtaatacacaccacctcagactaac |
498367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University