View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17941_high_47 (Length: 237)
Name: NF17941_high_47
Description: NF17941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17941_high_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 11 - 221
Target Start/End: Complemental strand, 42439577 - 42439367
Alignment:
| Q |
11 |
attatactattggcaaaccatttctttcaaacataatttcaatctaaaactcaagcaaaacctcaagagttgaaaccgaccatcaaactttcaaaataaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42439577 |
attatactattggcaaaccatttctttcaaacataatttcaatctaaaactcaagcaaaacctcaagagttgaaaccgaccatcaaactttcaaaataaa |
42439478 |
T |
|
| Q |
111 |
cagcataaccttcaacaatatatgaatctctacaaaatttgttgcgccaaaccttaccgcacaacaacataaccattgttgaccacatacgaggaaggag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42439477 |
cagcataaccttcaacaatatatgaatctctacaaaatttgttgcgccaaaccttaccgcacaacaacataaccattgttgaccacatacgaggaaggag |
42439378 |
T |
|
| Q |
211 |
attgtgaaaat |
221 |
Q |
| |
|
||||||||||| |
|
|
| T |
42439377 |
attgtgaaaat |
42439367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 100
Target Start/End: Complemental strand, 13570048 - 13569980
Alignment:
| Q |
32 |
ttctttcaaacataatttcaatctaaaactcaagcaaaacctcaagagttgaaaccgaccatcaaactt |
100 |
Q |
| |
|
|||||||||||| ||||||||| ||||| ||||||||||||||| | | ||||| |||||||||||| |
|
|
| T |
13570048 |
ttctttcaaacacaatttcaattgaaaacacaagcaaaacctcaacaatcgaaacacaccatcaaactt |
13569980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University