View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17941_low_16 (Length: 420)

Name: NF17941_low_16
Description: NF17941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17941_low_16
NF17941_low_16
[»] chr7 (1 HSPs)
chr7 (374-409)||(30168411-30168446)
[»] chr5 (1 HSPs)
chr5 (301-345)||(43245384-43245428)


Alignment Details
Target: chr7 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 374 - 409
Target Start/End: Original strand, 30168411 - 30168446
Alignment:
374 cccaattttggaagtcctacgtgtctttttcttctc 409  Q
    ||||||||||||||||||||||||||||||||||||    
30168411 cccaattttggaagtcctacgtgtctttttcttctc 30168446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 301 - 345
Target Start/End: Original strand, 43245384 - 43245428
Alignment:
301 aaagggaaatgctgaaatttacaaatgaaacaagcaagaaatgca 345  Q
    ||||| |||||||||||||||| |||| |||||||||||||||||    
43245384 aaaggaaaatgctgaaatttacgaatgtaacaagcaagaaatgca 43245428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University