View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17941_low_29 (Length: 352)
Name: NF17941_low_29
Description: NF17941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17941_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 7e-37; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 227 - 344
Target Start/End: Complemental strand, 25493245 - 25493128
Alignment:
| Q |
227 |
aactgttccacaaacttaagtccttatagaataagctagtggccgtagctgccaaaacaaagatcaat-agcatatctacatataggaagtgcatgccct |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| | | |||||||||||||||||||||||| ||| |
|
|
| T |
25493245 |
aactgttccacaaacttaagtccttatagaataagctagtggtcgtagctgccaaagcaaagatcagtaaccatatctacatataggaagtgcatctcct |
25493146 |
T |
|
| Q |
326 |
gaaataaaataaaataaaa |
344 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
25493145 |
gaaataaaa-aaaataaaa |
25493128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 159 - 230
Target Start/End: Complemental strand, 25493347 - 25493276
Alignment:
| Q |
159 |
tagaaacattaacactttggagagttgaaatctgaacatattgttatattgaaacagttcaagttcccaact |
230 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||| |||| ||| |||||||||||||||||||||||||| |
|
|
| T |
25493347 |
tagaaacattaacacttcggagagtcgaaatctgaagatatcgttgtattgaaacagttcaagttcccaact |
25493276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 185 - 231
Target Start/End: Complemental strand, 25501525 - 25501479
Alignment:
| Q |
185 |
gaaatctgaacatattgttatattgaaacagttcaagttcccaactg |
231 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
25501525 |
gaaatctgaacacattgtcatattgaaacagttcaagttcccaactg |
25501479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 16 - 62
Target Start/End: Complemental strand, 25493444 - 25493398
Alignment:
| Q |
16 |
aaaatgtatgggacaagtgaagcctgactaaataaacaaagctatta |
62 |
Q |
| |
|
||||||| |||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
25493444 |
aaaatgtttgggacaagtaaagcttgactaaataaacaaagctatta |
25493398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University