View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17941_low_30 (Length: 343)
Name: NF17941_low_30
Description: NF17941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17941_low_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 15 - 322
Target Start/End: Original strand, 38878632 - 38878939
Alignment:
| Q |
15 |
caaaggcgcaatcaagcagcaaatccgttagcaagtaactcaacatcacgttaattaaaattattgaaacaaactttgtgaaactcaaagagaagatgat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38878632 |
caaaggcgcaatcaagcagcaaatccgttagcaagtaactcaacatcacgttaattaaaattattgaaacaaactttgtgaaactgaaagagaagatgat |
38878731 |
T |
|
| Q |
115 |
tgacgagacaagtctaaaaaactggagttagtttgcggttcggcgctcacagttatcgaaaaatgggattcaacgcagcggccaagtgtggagttataaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
38878732 |
tgacgagacaagtctaaaaaactggagttagtttgcggttcggcgctcacagttatcgaaaaatgggattcaacgccgcggccgagtgtggagttataaa |
38878831 |
T |
|
| Q |
215 |
tttgatatgagcatgtattttatttcatggtatagatagatagataaattatttgggtctcaacatgtttaaaaaataattataattcatgctaaggaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38878832 |
tttgatatgagcatgtattttatttcacggtatagatagatagatagattatttgggtctcaacatgtttaaaaaataattataattcatgctaaggaat |
38878931 |
T |
|
| Q |
315 |
gttccagc |
322 |
Q |
| |
|
|||||||| |
|
|
| T |
38878932 |
gttccagc |
38878939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University