View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17941_low_33 (Length: 334)
Name: NF17941_low_33
Description: NF17941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17941_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 6e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 77 - 305
Target Start/End: Complemental strand, 52634176 - 52633948
Alignment:
| Q |
77 |
tttattaattatattctcttatctaaaatacattaatatcacgatgtttccaaaaactatgttagcatgtccccttcaatttgtggtttctctgtttttt |
176 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
52634176 |
tttattcattatattctcttatctaaaatacattaatatcacgatgtttccaaaaactatgttagcaagtccccttcaatttgtggtttcgctgtttttt |
52634077 |
T |
 |
| Q |
177 |
atcgataaacatattaaaatcgtttcaatttatggttataaacaagacaagtattgcccctttacgatcactcacacgctattatgtagnnnnnnnnnnc |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
52634076 |
atcgataaacatattaaaatcgtttcaatttatggttataaacaagacaagtattgcccctttacgatcactcacacgctattatgtagttttttttttc |
52633977 |
T |
 |
| Q |
277 |
cttctcatagagttcaatgacaaaactca |
305 |
Q |
| |
|
||||||| ||||||||||||||||||||| |
|
|
| T |
52633976 |
cttctcaaagagttcaatgacaaaactca |
52633948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 34 - 71
Target Start/End: Original strand, 19264818 - 19264855
Alignment:
| Q |
34 |
ttcttaaccagtgtccggaacaccggttagcatgaccc |
71 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
19264818 |
ttcttaaccagtgtccggagcaccgattagcatgaccc |
19264855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 34 - 73
Target Start/End: Complemental strand, 17063204 - 17063164
Alignment:
| Q |
34 |
ttcttaaccagtgtc-cggaacaccggttagcatgaccctt |
73 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
17063204 |
ttcttaaccagtgtctcggagcaccggttagcatgaccctt |
17063164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University