View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17941_low_35 (Length: 325)
Name: NF17941_low_35
Description: NF17941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17941_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 9 - 309
Target Start/End: Original strand, 39108448 - 39108747
Alignment:
| Q |
9 |
gagaagaaaccaaaacctcaaatagtgttctgttttgatattttcatgattcaaccttgaatcttcttcactcacatcaccattttcaaccnnnnnnnnn |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39108448 |
gagaagaaaccaaaacctcaaatagtgttctgttttgatattttcatgattcaaccttgaatcttcttcaatcacatcaccattttcaaccaaaaaacaa |
39108547 |
T |
 |
| Q |
109 |
nnntggctgtcacaacttcctttctcaattcaacagagaaaaaacaacactggtggctcacaaaccgtaaagtaaacctctaaatatttcaccttaaatt |
208 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39108548 |
aaatggctgtcacaacttcctttctgaattcaacagagaaaaaacaacactggtggctcacaaaccgtaaggtaaacctctaaatatttcaccttaaatt |
39108647 |
T |
 |
| Q |
209 |
cttgttttgttttttcattctcaaaacatgtctgaatannnnnnnnnnnnnnnnnnatagattgttgagaaatatatcaaagatgcaagaacactcattg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39108648 |
cttgttttgttttttcattctcaaaacatgtctgaata-ttttttgtttttgttttatagattgttgagaaatatatcaaagatgcaagaacactcattg |
39108746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University