View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17941_low_50 (Length: 239)
Name: NF17941_low_50
Description: NF17941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17941_low_50 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 8270617 - 8270819
Alignment:
| Q |
1 |
tgaatttattcaataaaaacttttaaatcaatggttaaatttgtgaaatataattttttataatgagttattataaacagaatattttatgcagagttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8270617 |
tgaatttattcaataaaaacttttaaatcaatggttaaatttgtgaaatataattttttataatgagttattataaacagaaaattttatgcagagttac |
8270716 |
T |
|
| Q |
101 |
tcctcaagtaaactaatcatgaacaagaaacaagattggaggacataaaccaaaatacattgaaacaaataagaaagcttagaacgagtgttgaaaccac |
200 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |
|
|
| T |
8270717 |
tcctcaaataaactaatcatgaacaataaacaagattggaggacataaaccaaaatacattgaaacaaataagaaagcttataacgagtgttgaaacaac |
8270816 |
T |
|
| Q |
201 |
tac |
203 |
Q |
| |
|
||| |
|
|
| T |
8270817 |
tac |
8270819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University