View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17942_high_14 (Length: 346)
Name: NF17942_high_14
Description: NF17942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17942_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 279; Significance: 1e-156; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 18 - 328
Target Start/End: Complemental strand, 29663072 - 29662771
Alignment:
| Q |
18 |
gaaactccctctctgcctgcatccacttcatgccaatcaccacaactcgaaccttgacatccttcgcaatttcgggcattttttgattcatggagatttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29663072 |
gaaactccctctctgcctgcatccacttcatgccaatcaccacaactcgaaccttgacatccttcgcaatttcgggcattttttgattcatggagatttg |
29662973 |
T |
 |
| Q |
118 |
gttttcaccgagaatgtacatgtaacccagcatcttgctacttgagggataagcattcttaattggaccaattctcatgaaaaccccatgcttcaacatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29662972 |
gttttcaccgagaatgtacatgtaacccagcatcttgctacttgagggataagcattcttaattggaccaattctcatgaaaaccccatgct-------- |
29662881 |
T |
 |
| Q |
218 |
atattcatatggacaaccttgaaaatcttgaaggtcacaacattgaaaacaacttggaacagaacatcccctgtatgttgcctaactttcccttctccaa |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29662880 |
-tattcatatggacaaccttgaaaatcttgaaggtcacaacattgaaaacaacttggaacagaacatcccctgtatgttgcctaactttcccttctccaa |
29662782 |
T |
 |
| Q |
318 |
ttttatccagt |
328 |
Q |
| |
|
||||||||||| |
|
|
| T |
29662781 |
ttttatccagt |
29662771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 18 - 212
Target Start/End: Original strand, 33201385 - 33201579
Alignment:
| Q |
18 |
gaaactccctctctgcctgcatccacttcatgccaatcaccacaactcgaaccttgacatccttcgcaatttcgggcattttttgattcatggagatttg |
117 |
Q |
| |
|
|||| ||||||||||||| ||||||||| | || |||||||||||||||||||||||||| || ||||| | ||||||||| ||||||||| | | | |
|
|
| T |
33201385 |
gaaattccctctctgcctccatccactttgtaccgatcaccacaactcgaaccttgacatctttggcaatcttgggcattttctgattcatgaaatatgg |
33201484 |
T |
 |
| Q |
118 |
gttttcaccgagaatgtacatgtaacccagcatcttgctacttgagggataagcattcttaattggaccaattctcatgaaaaccccatgcttca |
212 |
Q |
| |
|
|||||||||||||| |||| || || ||||||||||||||||| |||| ||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
33201485 |
gttttcaccgagaacatacacatacccaggcatcttgctacttgagagataggcattctctattggaccaattcgcatgaaaaccccatgcttca |
33201579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 234 - 328
Target Start/End: Original strand, 33201613 - 33201707
Alignment:
| Q |
234 |
ccttgaaaatcttgaaggtcacaacattgaaaacaacttggaacagaacatcccctgtatgttgcctaactttcccttctccaattttatccagt |
328 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||| || ||||||||||| |||||||| ||||| |||||||||||| |
|
|
| T |
33201613 |
ccttgaaaatcttgaaggtcacggcattgaaaacaacagggaacagaacatctccagtatgttgcctgactttcccctctcctattttatccagt |
33201707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University