View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17942_high_28 (Length: 225)
Name: NF17942_high_28
Description: NF17942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17942_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 41848383 - 41848593
Alignment:
| Q |
1 |
tgacaaatatgagtcagagcctattcttctatcaaccattccagaacttcctgattttgagattgccggactttcaccggatatcagtaacttcgtcaga |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41848383 |
tgacaaatatgagtcagaacctattcttctatcaaccattccagaacttcctgattttgagattgccggactttcaccggatatcagtaacttcgtcaga |
41848482 |
T |
 |
| Q |
101 |
aagtcatcttctgagagatttacggcgccagctaatattggtatttcgtgtgcttgagggtagtctttaattacatgatggtgatataatattaacatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41848483 |
aagtcatcttctgagagatttacggcgccagctaatattggtatttcgtgtgcttgagggtagtctttaattacatgatggtgatataatattaacatat |
41848582 |
T |
 |
| Q |
201 |
aacaatatcaa |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
41848583 |
aacaatatcaa |
41848593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University