View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17942_low_12 (Length: 369)
Name: NF17942_low_12
Description: NF17942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17942_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 4 - 366
Target Start/End: Original strand, 14281215 - 14281582
Alignment:
| Q |
4 |
ccactctaccttttcctcgccaactacattgctacaaaaacctttgccctccccgaagtggatatagctggcctcaccaccgccgagataaataacctca |
103 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| | ||||| ||||||| || |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14281215 |
ccactctaccgtttcctcgccaactacattgctacaaaaacctcttccctcaccgaagtcgagatagctcgcctcaccaccgccgagataaataacctca |
14281314 |
T |
|
| Q |
104 |
tctctcaactccctgaacctgagatcaaccgcatcctcaacgccggcgtttccgagcttttcgccggcatcactgaacaaatcgctccttacttggccat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14281315 |
tctctcaactccctgaacctgagatcaaccgcatcctcaacgccggcgtttccgagcttttcgccggcatcactgaacaaatcgctccttacttggccat |
14281414 |
T |
|
| Q |
204 |
gttttttgccggtaacttcacactcgtcgctctttcttcatccattttatgtttgttaag-----ctcatctcatctcnnnnnnnnnnaggttgctttgg |
298 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
14281415 |
gttttttgccggtaacttcacactcattgctctttcttcatccattttatgtttgttaagctcatctcatctcatctcttttttttttaggttgctttgg |
14281514 |
T |
|
| Q |
299 |
cctcacactcctaagttgcttcttcatttaccgggtattagagtttcacattattccttttcattcat |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14281515 |
cctcacactcctaagttgcttcttcatttaccgggtattagagtttcacattattccttttcattcat |
14281582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University