View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17942_low_21 (Length: 285)
Name: NF17942_low_21
Description: NF17942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17942_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 26 - 271
Target Start/End: Complemental strand, 16463359 - 16463117
Alignment:
| Q |
26 |
attattcttcctttatacaaagatgtttaaaaatcacccttaggcttttgcattcaataagtgttttaaattgtgatggcaatcgtgcgattttagaagt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
16463359 |
attattcttcctttatacaaagatgtttaaaaatcacccttaggcttttgcattcaataagttttttatattgtgatggcaatcgtgcgattttagaagt |
16463260 |
T |
|
| Q |
126 |
ctttgcaactgcatcttgaccacaaaatattgtaattgcgatcgtgattgtaacttaaaatcttgttcatgcatttaacattttctgaaattgtttgact |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16463259 |
ctttgcaactgcatcttgaccacaaaatattgtaattgcgatcgtgattgtaacttaaaatcttgttcatgcatttaacattttctgaaattgtttgact |
16463160 |
T |
|
| Q |
226 |
ggctgaataacaggaagtttttatgcaaaggatgatagaacttact |
271 |
Q |
| |
|
| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16463159 |
gactg---aacaggaagtttttatgcaaaggatgatagaacttact |
16463117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University