View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17942_low_31 (Length: 233)
Name: NF17942_low_31
Description: NF17942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17942_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 219
Target Start/End: Original strand, 37494625 - 37494829
Alignment:
| Q |
18 |
cttttggcattctaaaaaagcagatagtagatttggataaagagggtgagttgcgatctggttcttgataattcgatccgtcgtcatatccaaccttatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37494625 |
cttttggcattctaaaaaagcagatagtagatttggataaagagggtgagttgcgatctggttcttgataattcgatccgtcgtcatatccaaccttatt |
37494724 |
T |
 |
| Q |
118 |
agatctgattggttgtgttccatgtgaaggtagttattattattatt---agcagcagcacacacgagtcctcctagatgcaatccagcagcagtgtaag |
214 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37494725 |
agatctgatcggttgtgttccatgtgaaggtagttattattattattagcagcagcagcacacacgagtcctcctagatgcaatccagcagcagtgtaag |
37494824 |
T |
 |
| Q |
215 |
aataa |
219 |
Q |
| |
|
||||| |
|
|
| T |
37494825 |
aataa |
37494829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University