View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17942_low_34 (Length: 205)
Name: NF17942_low_34
Description: NF17942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17942_low_34 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 10 - 205
Target Start/End: Original strand, 1632392 - 1632587
Alignment:
| Q |
10 |
agaagaagacggccctatcacttctgtgagttgggctcctgatgggcgtcatattggtattggtttgaacaactctgaagtgcagctatgggatacagct |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1632392 |
agaagaagacggccctatcacttctgtgagttgggctcctgatgggcgtcatattggtattggtttgaacaactctgaagtgcagctatgggatacagct |
1632491 |
T |
 |
| Q |
110 |
tcagataaacaggtttttacacttacctagttaaccacctttatgaactatcaaattcctgctagtttgctaacattattcttgtttggtttctgc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1632492 |
tcagataaacaggtttttacacttacctagttaaccacctttatgaactatcaaattcccgctagtttgctaacattattcttgtttggtttctgc |
1632587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 14 - 126
Target Start/End: Original strand, 20456321 - 20456433
Alignment:
| Q |
14 |
gaagacggccctatcacttctgtgagttgggctcctgatgggcgtcatattggtattggtttgaacaactctgaagtgcagctatgggatacagcttcag |
113 |
Q |
| |
|
||||| ||||||||||| ||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20456321 |
gaagatggccctatcacatctgtaagttgggctccagatgggcgtcatattggcattggtttgaacaactctgaagtgcagctatgggatacagcttcag |
20456420 |
T |
 |
| Q |
114 |
ataaacaggtttt |
126 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
20456421 |
atagacaggtttt |
20456433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University