View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17943_high_28 (Length: 244)
Name: NF17943_high_28
Description: NF17943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17943_high_28 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 17 - 244
Target Start/End: Complemental strand, 27191203 - 27190976
Alignment:
| Q |
17 |
agttgaagaaccaaagaaaacttttcctttggctcttttaattgctgttattttcacctgtgtttcttatttgattccactttttgctgttactggagct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27191203 |
agttgaagaaccaaagaaaacttttcctttggctcttttaattgctgttattttcacttgtgtttcttatttgattccactttttgctgttactggagct |
27191104 |
T |
|
| Q |
117 |
gtgaatgtgaatcaaagtgaatgggaaactgggtttcatgctcaagctgctgagattattgctggaaaatggttgaaaatttgggttgaaattggtgctg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27191103 |
gtgaatgtgaatcaaagtgaatgggaaactgggtttcatgctcaagctgctgagattattgctggaaaatggttgaaaatttgggttgaaattggtgctg |
27191004 |
T |
|
| Q |
217 |
ttttatcagcaattgggctttttgaagc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
27191003 |
ttttatcagcaattgggctttttgaagc |
27190976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University