View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17943_low_36 (Length: 227)
Name: NF17943_low_36
Description: NF17943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17943_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 5568983 - 5569201
Alignment:
| Q |
1 |
tttatgctttttaatgaacccaagtgagctaaatctatggttgggg-ggctgggattccactggacccttcggtgattggagaggatccgtgcctgtgct |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5568983 |
tttatgctttttaatgaacccaagtgagctaaatctatggttgggggggctgggattccactggacccttcggtgattggagaggatccgtgcctgtgct |
5569082 |
T |
|
| Q |
100 |
aatgttatttgtcacttaggtccttgataacatgtataagaatatggtgaagaaatggtaccacatatgcagctgatgtgtcaaaaaatgtgacacatca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5569083 |
aatgttatttgtcacttaggtccttgataacatgtataagaatatggtgaataaatggtaccacatatgcagctgatttgtcaaaaaatgtgacacatca |
5569182 |
T |
|
| Q |
200 |
tcacaactagtagaataat |
218 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
5569183 |
tcacaactagtagaataat |
5569201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 88
Target Start/End: Original strand, 43027173 - 43027211
Alignment:
| Q |
50 |
tgggattccactggacccttcggtgattggagaggatcc |
88 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
43027173 |
tgggattccactggaccctccagtgattggagaggatcc |
43027211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 26635477 - 26635433
Alignment:
| Q |
1 |
tttatgctttttaatgaacccaagtgagctaaatctatggttggg |
45 |
Q |
| |
|
|||||||||||||||||||||| || ||| ||||| ||||||||| |
|
|
| T |
26635477 |
tttatgctttttaatgaacccaggtcagccaaatcaatggttggg |
26635433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University