View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17943_low_6 (Length: 475)
Name: NF17943_low_6
Description: NF17943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17943_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 8e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 8e-62
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 47367053 - 47367177
Alignment:
| Q |
1 |
aagcaaaagtaagatcaacaagcacaccaaaaacaagaataggaaggaattgggacatgagctctgattgctattcaccaagcaaaagaatgataaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47367053 |
aagcaaaagtaagatcaacaagcacaccaaaaacaagaataggaaggaattgggacatgagctctgattgctattcaccaagcaaaagaatgatcaataa |
47367152 |
T |
 |
| Q |
101 |
taatcaacaacaaggatctcctagc |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
47367153 |
taatcaacaacaaggatctcctagc |
47367177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 11 - 57
Target Start/End: Original strand, 39455476 - 39455522
Alignment:
| Q |
11 |
aagatcaacaagcacaccaaaaacaagaataggaaggaattgggaca |
57 |
Q |
| |
|
|||||||||| |||||| ||||| ||| ||||||||||||||||||| |
|
|
| T |
39455476 |
aagatcaacaggcacacaaaaaataaggataggaaggaattgggaca |
39455522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University