View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17944_low_3 (Length: 277)
Name: NF17944_low_3
Description: NF17944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17944_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 16 - 262
Target Start/End: Original strand, 37430476 - 37430722
Alignment:
| Q |
16 |
atgggtaatcccttttgagccgtctttatttatgaatggaatctcatttctttcgaccaaaaagaaatgcannnnnnnaacccaacaaaaacacctttcg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37430476 |
atgggtaatcccttttgagccgtctttatttatgaatggaatctcatttctttcgaccaaaaagaaatgcatttttttaacccaacaaaaacacctttcg |
37430575 |
T |
 |
| Q |
116 |
ctagaggggcgcgagtatattatgttgaatacatagagtatattaatctctcttactcaactgatagctagttaaggatgtaagcaactaaagagaagct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
37430576 |
ctagaggggcgcgagtatattatgttgaatacatagagtatattaatctctcttactcaactgatagctagttaaggatggaagcaactaaagaaaagct |
37430675 |
T |
 |
| Q |
216 |
agaacaaatagcctaaaccaatatagttcagacagaaatgacttggt |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37430676 |
agaacaaatagcctaaaccaatatagttcagacagaaatgacttggt |
37430722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University