View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17944_low_5 (Length: 202)
Name: NF17944_low_5
Description: NF17944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17944_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 55694927 - 55694768
Alignment:
| Q |
1 |
aagtaactcatagggaacatgatcaaaacatacttcataattcatatgtcttatattcaaataacttgatagatatttttgattgaagtgctgcttctaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55694927 |
aagtaactcatagggaacatgatcaaaacatacttcataattcatatgtcttatattcaaataacttgatagatatttttgattgaagtgctgcttctag |
55694828 |
T |
 |
| Q |
101 |
taataaaaatacaatgtagtagaatcaattattttttcaagagcaaattgattattgatc |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55694827 |
taataaaaatacaatgtagtagaatcaattattttttcaagagcaaattgattattgatc |
55694768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University