View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17944_low_5 (Length: 202)

Name: NF17944_low_5
Description: NF17944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17944_low_5
NF17944_low_5
[»] chr4 (1 HSPs)
chr4 (1-160)||(55694768-55694927)


Alignment Details
Target: chr4 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 55694927 - 55694768
Alignment:
1 aagtaactcatagggaacatgatcaaaacatacttcataattcatatgtcttatattcaaataacttgatagatatttttgattgaagtgctgcttctaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
55694927 aagtaactcatagggaacatgatcaaaacatacttcataattcatatgtcttatattcaaataacttgatagatatttttgattgaagtgctgcttctag 55694828  T
101 taataaaaatacaatgtagtagaatcaattattttttcaagagcaaattgattattgatc 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55694827 taataaaaatacaatgtagtagaatcaattattttttcaagagcaaattgattattgatc 55694768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University