View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17945_high_19 (Length: 357)
Name: NF17945_high_19
Description: NF17945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17945_high_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 176 - 342
Target Start/End: Complemental strand, 3414097 - 3413931
Alignment:
| Q |
176 |
gtagatcaaatactttgaaaacaagctagagggctccaatatgaaaaaaccagattagatttcttcaaaaattattgaaaataagtcatcattgtcaacg |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3414097 |
gtagatcaaatactttgaaaacaagctagatggttccaatatgaaaaaaccagattagatttcttcaaaaattattgaaaataagtcatcattgtcaacg |
3413998 |
T |
|
| Q |
276 |
tattaagcctagataagaataatgttatattatacacacatttgatatggaaagataatatgatcat |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3413997 |
tattaagcctagataagaataatgttatattatacacacatttgatatggaaagataatatgatcat |
3413931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 15 - 102
Target Start/End: Complemental strand, 3414258 - 3414171
Alignment:
| Q |
15 |
attctcgatcaataagttaaatatatgtatcatcataattaaggagttgaattagatgaactagaaaaataagagatatcaccatgat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3414258 |
attctcgatcaataagttaaatatatgtatcatcataattaaggagttgaattagatgaactagaaaaataagagatatcaccatgat |
3414171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University