View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17945_high_22 (Length: 329)
Name: NF17945_high_22
Description: NF17945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17945_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 309
Target Start/End: Complemental strand, 2144560 - 2144253
Alignment:
| Q |
1 |
ctagtttgtaggtgatgggtgtgagtacattgtaagttttatttgtgctttgaggtgtgacttggccgtagtgaatgaaaagtttatcactgcacttttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2144560 |
ctagtttgtaggtgatgggtgtgagtacattgtaagctttatttgtgctttgaggtgtgacttggccgtagtgaatgaaaagtttatcactgcacttttt |
2144461 |
T |
 |
| Q |
101 |
ctttactagctgaaacattatatcctcagacgcttgaactgttttctttcttgtctggtcttttttaaggtgataaaaccgatagttgctcgataggtcc |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2144460 |
-tttactagctgaaacataatatcctcagacgcttgaactgttttctttcttgtctggtcttttttaaggtgataaaaccgatagttgctcgataggtcc |
2144362 |
T |
 |
| Q |
201 |
cttggatttctcatagacccctcaaccaatctggtcataacttccgatcgggnnnnnnnagaaaacgtgagcaatttgaggggcctattattgagcaacc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2144361 |
cttggatttctcatagacccctcaaccaatctggtcataacttccgatcgggtttttttagaaaacgtgagcaatttgaggggcctattattgagcaacc |
2144262 |
T |
 |
| Q |
301 |
atcgacaat |
309 |
Q |
| |
|
||||||||| |
|
|
| T |
2144261 |
atcgacaat |
2144253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University