View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17945_high_32 (Length: 257)
Name: NF17945_high_32
Description: NF17945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17945_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 16031810 - 16032010
Alignment:
| Q |
1 |
agaaaaataatttgaactcgaataggacggtagctgagaaaataaagatgaatggatactctcaactttatatacttcaattaatttgacctttgggttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16031810 |
agaaaaataatttgaactcgaataggacggtagctgagaaaataaggatgaatggatactctccactttatatacttcaattaatttgacctttgggttg |
16031909 |
T |
 |
| Q |
101 |
taatcaacctttggaaag-gaaaacaaaacttagtattgggaaacgaagggatccatt-ttaatgtgatgagagattagtcaaacttggaagaagtgtta |
198 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16031910 |
taatcaacctttggaaagagaaaaaaaaacttagtattgggaaacgaagggatccattgttaatgtgatgagagattagtcaaacttggaagaagtgtta |
16032009 |
T |
 |
| Q |
199 |
a |
199 |
Q |
| |
|
| |
|
|
| T |
16032010 |
a |
16032010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University