View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17945_high_38 (Length: 247)
Name: NF17945_high_38
Description: NF17945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17945_high_38 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 25 - 231
Target Start/End: Complemental strand, 1922462 - 1922247
Alignment:
| Q |
25 |
ttaatttgttgtcgaatttgaaagttaattgatgatttggctataacttgattaggttccttaaacattgtaacaagcaagaatannnnnnngaaagaag |
124 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
1922462 |
ttaatttgttgtcgaatttaaaagttaaccgatgatttggctataactcgattaggttccttaaatattgtaacaagcaagaata-ttttttgaaagaag |
1922364 |
T |
|
| Q |
125 |
acatgtttgttacaatgtttaagcaagaatatccaaaactaactcgattag--------aagcgtagaggtttgtgattttttgactc--atatatgggt |
214 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||| |||||||| | |
|
|
| T |
1922363 |
acatgcttgttacaatgtttaagcaagaatatccaaaactaactcgattaggttcctgatagcgtaggggtttgtgatttttttactcttatatatggat |
1922264 |
T |
|
| Q |
215 |
atgacatgcttgggttc |
231 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
1922263 |
atgacatgcttgtgttc |
1922247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University