View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17945_high_40 (Length: 241)
Name: NF17945_high_40
Description: NF17945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17945_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 3568752 - 3568979
Alignment:
| Q |
1 |
acagctggttgcacgtgaggatgctgcccattcagatatctctatggcaaatctttaagcaacagtaacattcatgagattggttctaacaaggatatac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3568752 |
acagctggttgcacgtgaggatgctgcccattcagatatctctatggcaaatctttaagcaacagtaacattcatgagattggttctaacaaggatatat |
3568851 |
T |
 |
| Q |
101 |
atcctaacatccaacatgacatggaacttgttggtaattcaggtaccgtcatgtctgaagatagtagcatgcttgcggttcaacctgattttttggcaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3568852 |
atcctaacatccaacatgacatggaacttgttggtaattcaggtaccgtcatgtctgaagatagtagcatgcttgcggttcaacctggttttttggcaga |
3568951 |
T |
 |
| Q |
201 |
tgatatagttcattatagtaacacaggt |
228 |
Q |
| |
|
||||||||||||| |||||||||||||| |
|
|
| T |
3568952 |
tgatatagttcataatagtaacacaggt |
3568979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 232
Target Start/End: Original strand, 18485273 - 18485357
Alignment:
| Q |
148 |
gtcatgtctgaagatagtagcatgcttgcggttcaacctgattttttggcagatgatatagttcattatagtaacacaggttctg |
232 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| | ||||||||||||||| |||||| | || |||||| |||||||| |
|
|
| T |
18485273 |
gtcatgtctgaaggcagtagcatgctcgcggttcagtttaattttttggcagatgcggtagttcttaatggtaacataggttctg |
18485357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University