View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17945_high_43 (Length: 222)
Name: NF17945_high_43
Description: NF17945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17945_high_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 15 - 195
Target Start/End: Complemental strand, 21624527 - 21624347
Alignment:
| Q |
15 |
gcaaagggagcaatatatggctaaacttatgaagtttgcttattttatgattctcttcctttctctgtatcttgttgcaagtaagccatttccccttaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21624527 |
gcaaagggagcaatatatggctaaacttatgaagtttgtttattttatgattctcttcctttctctgtatcttgttgcaagtaagccatttccccttaca |
21624428 |
T |
|
| Q |
115 |
agcactgactataagccgtcttttaaagtctcatctttacttattatctatatgcacggacactccttggattaggtgtgt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21624427 |
agcactgactataagccgtcttttaaagtctcatctttacttattacctatatgcacggacactccttggattaggtgtgt |
21624347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 201
Target Start/End: Original strand, 34006937 - 34006970
Alignment:
| Q |
168 |
gcacggacactccttggattaggtgtgttccggt |
201 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
34006937 |
gcacggacactccttgaattaggtgtgttccggt |
34006970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 201
Target Start/End: Complemental strand, 848073 - 848041
Alignment:
| Q |
169 |
cacggacactccttggattaggtgtgttccggt |
201 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
848073 |
cacggacactccttggattaggtgtgtcccggt |
848041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University