View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17945_low_20 (Length: 340)
Name: NF17945_low_20
Description: NF17945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17945_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 255
Target Start/End: Complemental strand, 26573810 - 26573572
Alignment:
| Q |
18 |
aaggttgtattccgtgattatcacttcactctccattcagtttaaaacatggcatattagaatgaatgttcagttgcagggtataaaatggagacaacct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26573810 |
aaggttgtattccgtgattatcacttcactctccattcagtttaaaacatggcatattagaatgaatgttcagttgcagggtataaaatggagacaacct |
26573711 |
T |
 |
| Q |
118 |
tcgttcaatcttatttttgttcttcttcaattgaattgattgagttatagatggggataa-gggtgaagggtggcctctcggaaagggaatggttgatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26573710 |
tcgttcaatcttatttttgttcttcttcaattgaattgattgagttatagatggggataaggggtgaagggtggcctctgggaaagggaatggttgatat |
26573611 |
T |
 |
| Q |
217 |
ttggttctttgtggtagaattttttgttgaataatgtgt |
255 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26573610 |
ttggttctttgtggtataattttttgttgaataatgtgt |
26573572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University