View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17945_low_33 (Length: 257)

Name: NF17945_low_33
Description: NF17945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17945_low_33
NF17945_low_33
[»] chr4 (1 HSPs)
chr4 (1-199)||(16031810-16032010)


Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 16031810 - 16032010
Alignment:
1 agaaaaataatttgaactcgaataggacggtagctgagaaaataaagatgaatggatactctcaactttatatacttcaattaatttgacctttgggttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
16031810 agaaaaataatttgaactcgaataggacggtagctgagaaaataaggatgaatggatactctccactttatatacttcaattaatttgacctttgggttg 16031909  T
101 taatcaacctttggaaag-gaaaacaaaacttagtattgggaaacgaagggatccatt-ttaatgtgatgagagattagtcaaacttggaagaagtgtta 198  Q
    |||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
16031910 taatcaacctttggaaagagaaaaaaaaacttagtattgggaaacgaagggatccattgttaatgtgatgagagattagtcaaacttggaagaagtgtta 16032009  T
199 a 199  Q
    |    
16032010 a 16032010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University