View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17945_low_34 (Length: 255)
Name: NF17945_low_34
Description: NF17945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17945_low_34 |
 | |
|
| [»] scaffold0262 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 10 - 241
Target Start/End: Original strand, 21336832 - 21337063
Alignment:
| Q |
10 |
attatactaaatcataacgttgaatttcttcaaattttaatcataggatgtcgaatttatacggtgattataatcagaagatcgattacgttttcaaagt |
109 |
Q |
| |
|
||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21336832 |
attattctaaatcgtaacgttgaatttcttcatattttaatcataggatgtcgaatttatacggtgattataatcagaagatcgattacgttttcaaagt |
21336931 |
T |
|
| Q |
110 |
ggtgttgattggtgattctgccgttggaaaaacacaacttcttgctcgtttttcgaggaatcaatttaacgttgattctaaagctacaattggtgttgag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21336932 |
ggtgttgattggtgattctgccgttggaaaaacacaacttcttgctcgtttttcgaggaatcaatttaacgttgattctaaagctacaattggtgttgag |
21337031 |
T |
|
| Q |
210 |
tttcaaaccaaaactcttgttattgataataa |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21337032 |
tttcaaaccaaaactcttgttattgataataa |
21337063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0262 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 57 - 241
Target Start/End: Original strand, 13029 - 13213
Alignment:
| Q |
57 |
atgtcgaatttatacggtgattataatcagaagatcgattacgttttcaaagtggtgttgattggtgattctgccgttggaaaaacacaacttcttgctc |
156 |
Q |
| |
|
||||| ||||| |||||||||||||| ||||||||||| || ||||| || || ||||||||||||||||| ||||||||||| ||| | || | || |
|
|
| T |
13029 |
atgtctaatttgtacggtgattataacacaaagatcgattatgtattcaaggttgtattgattggtgattctgcagttggaaaaactcaattactcggtc |
13128 |
T |
|
| Q |
157 |
gtttttcgaggaatcaatttaacgttgattctaaagctacaattggtgttgagtttcaaaccaaaactcttgttattgataataa |
241 |
Q |
| |
|
||||| | ||||| ||||||| |||||||||||||| |||||||||||||| |||||||| |||||| | ||||||||||||| |
|
|
| T |
13129 |
gttttgcaaggaacgaatttaaagttgattctaaagccacaattggtgttgaatttcaaacaaaaactttgattattgataataa |
13213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 17 - 103
Target Start/End: Complemental strand, 36794559 - 36794477
Alignment:
| Q |
17 |
taaatcataacgttgaatttcttcaaattttaatcataggatgtcgaatttatacggtgattataatcagaagatcgattacgtttt |
103 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| || ||| |||||||| ||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
36794559 |
taaatcataacattgaatttc----aattttaatcttatgatatcgaatttgtacggtgattataatcagaagatcggttatgtttt |
36794477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 217
Target Start/End: Complemental strand, 39434441 - 39434413
Alignment:
| Q |
189 |
aaagctacaattggtgttgagtttcaaac |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39434441 |
aaagctacaattggtgttgagtttcaaac |
39434413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University