View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17945_low_40 (Length: 244)
Name: NF17945_low_40
Description: NF17945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17945_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 17 - 237
Target Start/End: Original strand, 15634697 - 15634917
Alignment:
| Q |
17 |
acaaatttggtgtaaaccgcagagggctacacattgatatgagcactacacccaggtacatcaaaagtcataaaatagaagatctcacgtctttcaaata |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15634697 |
acaaatttggtgtaaaccgcagagggctacacattgatatgagcactacgcctaggtacatcaaaagtcataaaatagaatatctcacgtctttcaaata |
15634796 |
T |
 |
| Q |
117 |
gtgaattctagtggtcacgagttttattccaaggttgatagccttcatgtgggccacgaaatattgaatccatggcgagtgccctccaccnnnnnnnntt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
15634797 |
gtgaattctagtggtcacgagttttattccaaggttgatagccttcatgtgggccacaaaatattgaatccatggcgagtgccctccaccaaaaactttt |
15634896 |
T |
 |
| Q |
217 |
caaattgctcgccctttgcta |
237 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
15634897 |
caaattgctcgcccttggcta |
15634917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University