View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17945_low_41 (Length: 241)

Name: NF17945_low_41
Description: NF17945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17945_low_41
NF17945_low_41
[»] chr3 (1 HSPs)
chr3 (1-228)||(3568752-3568979)
[»] chr4 (1 HSPs)
chr4 (148-232)||(18485273-18485357)


Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 3568752 - 3568979
Alignment:
1 acagctggttgcacgtgaggatgctgcccattcagatatctctatggcaaatctttaagcaacagtaacattcatgagattggttctaacaaggatatac 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
3568752 acagctggttgcacgtgaggatgctgcccattcagatatctctatggcaaatctttaagcaacagtaacattcatgagattggttctaacaaggatatat 3568851  T
101 atcctaacatccaacatgacatggaacttgttggtaattcaggtaccgtcatgtctgaagatagtagcatgcttgcggttcaacctgattttttggcaga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
3568852 atcctaacatccaacatgacatggaacttgttggtaattcaggtaccgtcatgtctgaagatagtagcatgcttgcggttcaacctggttttttggcaga 3568951  T
201 tgatatagttcattatagtaacacaggt 228  Q
    ||||||||||||| ||||||||||||||    
3568952 tgatatagttcataatagtaacacaggt 3568979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 232
Target Start/End: Original strand, 18485273 - 18485357
Alignment:
148 gtcatgtctgaagatagtagcatgcttgcggttcaacctgattttttggcagatgatatagttcattatagtaacacaggttctg 232  Q
    |||||||||||||  ||||||||||| ||||||||   | |||||||||||||||   |||||| | || |||||| ||||||||    
18485273 gtcatgtctgaaggcagtagcatgctcgcggttcagtttaattttttggcagatgcggtagttcttaatggtaacataggttctg 18485357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University