View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17945_low_43 (Length: 238)
Name: NF17945_low_43
Description: NF17945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17945_low_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 206
Target Start/End: Complemental strand, 47916944 - 47916756
Alignment:
| Q |
18 |
ctttgcatctttaataactttcacaacatccaaatagcaatctctactcatcaccttagaatcacagccaggaatagcacatttagacccttttgcacca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47916944 |
ctttgcatctttaataactttcacaacatccaaatagcaatctctactcatcaccttagaatcacagccaggaatagcacatttagacccttttgcacca |
47916845 |
T |
 |
| Q |
118 |
gccatctgtggatgatttacttcagattctgtaactttatccattaaagtatgagcactggttacgcagttaaatcctccggtgaaaat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47916844 |
gccatctgtggatgatttacttcagattctgtaactttatccattaaagtatgagcactggttacgcagttaaatcctccggtgaaaat |
47916756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 63 - 163
Target Start/End: Original strand, 29920449 - 29920549
Alignment:
| Q |
63 |
actcatcaccttagaatcacagccaggaatagcacatttagacccttttgcaccagccatctgtggatgatttacttcagattctgtaactttatccatt |
162 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29920449 |
actcatcaccttcgaatcacagccaggaatagcacatttagacccttttgcaccagccatctgtggatgatttacttcagattctgtaactttatccatt |
29920548 |
T |
 |
| Q |
163 |
a |
163 |
Q |
| |
|
| |
|
|
| T |
29920549 |
a |
29920549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University