View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17945_low_49 (Length: 210)
Name: NF17945_low_49
Description: NF17945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17945_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 75 - 195
Target Start/End: Original strand, 39305608 - 39305725
Alignment:
| Q |
75 |
gttcatattgtttgggtgcacttcattttattatgagctacactaaatgtttgttcgtagatattattattctacgcaggtatacatagaaaatatggta |
174 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39305608 |
gttcatattgtttgggtgcaattcattttattatgagctacactaaatgtttgttcgtaga---tattattctacgcaggtatacatagaaaatatggta |
39305704 |
T |
 |
| Q |
175 |
acaacaaaggtagcaattatt |
195 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39305705 |
acaacaaaggtagcaattatt |
39305725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University