View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17946_high_3 (Length: 320)
Name: NF17946_high_3
Description: NF17946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17946_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 294
Target Start/End: Original strand, 42454107 - 42454413
Alignment:
| Q |
1 |
cctgtgcgtacgatgttggcagttgatttttacacgtgcacttttgaagttgatgcaaaggtcattagtttatattattgtaaacatattaatgagatgt |
100 |
Q |
| |
|
||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42454107 |
cctgtgcgtacgacgttagcagttgatttt-acacgtgcacttttgaagttgatgcaaaggtcattagtttatattattgtaaacatattaatgagatgt |
42454205 |
T |
 |
| Q |
101 |
tttataatcgtcatggagacatgttttttggcttttgaggggaatagagacatatgtttgaactttgaatggtggttgtgacctgtgaagccataacaa- |
199 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42454206 |
tttataatcgtcatcgagacatgttttttggcttttgaggggaatagagacatatgtttgaactttgaatggtggttgtgacctgtgaagccataacaag |
42454305 |
T |
 |
| Q |
200 |
-agt---------tgtaatattgatttgagctactatattcttattgctcattgttagcaaa---tatttggattttaattgaccgtttcagaaacttct |
286 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42454306 |
tagtagtgattcatgtaatattgatttgagctactatattcttattgctcatagttagcaaatactatttggattttaattgaccgtttcagaaacttct |
42454405 |
T |
 |
| Q |
287 |
caatcaaa |
294 |
Q |
| |
|
|||||||| |
|
|
| T |
42454406 |
caatcaaa |
42454413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University