View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17946_low_6 (Length: 235)
Name: NF17946_low_6
Description: NF17946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17946_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 16 - 174
Target Start/End: Complemental strand, 4883009 - 4882851
Alignment:
| Q |
16 |
tagcataggatacatggccaagatctacgttggtggtatttgccatagtttctaaataggggtctagatgcactataataacggttgcttaatgcatttt |
115 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4883009 |
tagcataggatacatggccaacatctacgtcggtggtatttgccatagtttctaaataggggtctagatgcactataataacggttgcttaatgcatttt |
4882910 |
T |
 |
| Q |
116 |
agaaatcacatttaacacttaaaagatcgtcgattatatgtacatgattaagtattcaa |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4882909 |
agaaatcacatttaacacttaaaagatcgtcgattatatgtacatgattaagtattcaa |
4882851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 85 - 170
Target Start/End: Complemental strand, 28383658 - 28383572
Alignment:
| Q |
85 |
gcactataataacggttgcttaatgcattttagaaatcacatttaacacttaaaa-gatcgtcgattatatgtacatgattaagtat |
170 |
Q |
| |
|
||||| |||||| || | |||||||||||||||||||||||| ||| | ||||| ||||||| | ||||| ||||||||||||||| |
|
|
| T |
28383658 |
gcactgtaataagggctccttaatgcattttagaaatcacatccaacgcataaaacgatcgtcaaatatatttacatgattaagtat |
28383572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University