View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17947_high_10 (Length: 347)
Name: NF17947_high_10
Description: NF17947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17947_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 128 - 339
Target Start/End: Original strand, 46470635 - 46470846
Alignment:
| Q |
128 |
ttaaccttgaattcttagaagttacattacttatggatgaaaagtaatccgagcctgaggttatctctaattacttagattaaaattagcattaacaatc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46470635 |
ttaaccttgaattcttagaagttacattacttatggatgaaaagtaatccgagcctgaggttatctctaattacttagattaaaattagcattaacaatc |
46470734 |
T |
 |
| Q |
228 |
gtagattacctttttgacgttagatgaactaagggtagtttagcagcagcagcaacaactggattaggaccctgcaactcgcttctaattgcaaagtttc |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46470735 |
gtagattacctttttgactttagatgaactaagggtagtttagcagcagcagcaacaactggattaggaccctgcaactcgcttctaattgcaaagtttc |
46470834 |
T |
 |
| Q |
328 |
ttccatattctt |
339 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
46470835 |
ttccattttctt |
46470846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 18 - 126
Target Start/End: Original strand, 46470490 - 46470598
Alignment:
| Q |
18 |
atgtcatatagtagttggaattttacattccattttcctttgtttttctgattttcagtttaaatcaataatgtgaaaatgaacacaatgctatcaaaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46470490 |
atgtcatatagtagttggaattttacattccattttcctttgtttttctgattttcattttaaatcaataatgtgaaaatgaacacaatgctatcaaaca |
46470589 |
T |
 |
| Q |
118 |
tttaagttc |
126 |
Q |
| |
|
||||||||| |
|
|
| T |
46470590 |
tttaagttc |
46470598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University