View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17947_low_20 (Length: 251)

Name: NF17947_low_20
Description: NF17947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17947_low_20
NF17947_low_20
[»] chr8 (1 HSPs)
chr8 (17-243)||(41821110-41821336)


Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 17 - 243
Target Start/End: Complemental strand, 41821336 - 41821110
Alignment:
17 ataggatgctttggtttcaatggatccttctctttcttgttcttcttgctctccttttctgcatcttgtttgaattgcataaactgttcaagcaattcca 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41821336 ataggatgctttggtttcaatggatccttctctttcttgttcttcttgctctccttttctgcatcttgtttgaattgcataaactgttcaagcaattcca 41821237  T
117 tagcagtcttctgcttctgttcctcttctaagagtttcattgcctcaatttcacgtttttcctttgtaattacttgcaaataagcctctttttcagcttg 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41821236 tagcagtcttctgcttctgttcctcttctaagagtttcattgcctcaatttcacgtttttcctttgtaattacttgcaaataagcctctttttcagcttg 41821137  T
217 gtatttctcctcataaggcttcttctc 243  Q
    |||||||||||||||||||||||||||    
41821136 gtatttctcctcataaggcttcttctc 41821110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University